Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249237

Morpholino Name: cbfa2t3 MO1
Synonyms: mtg16
mRNA Target: cbfa2t3

Morpholino Type: uncategorized morpholino
Sequence:
5' TGAGTCTGGCATTGTAAACGCTGTA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' TACAGCGGTTACAATGCCAGACTCA 3' ||||||| ||||||||||||||||| 3' ATGTCGCAAATGTTACGGTCTGAGT 5' 5' TACAGCGTTTACAATGCCAGACTCA 3' ||||||||||||||||||||||||| 3' ATGTCGCAAATGTTACGGTCTGAGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold10177:540526..540550 25/25 Antisense target cbfa2t3.L
Scaffold344679:65825..65849 23/25 Antisense off-target Xelaev16045067m
tropicalis 7.1 scaffold_4:43436296..43436320 24/25 Antisense target cbfa2t3
scaffold_1:150576395..150576419 21/25 unknown
scaffold_3b:4026591..4026615 21/25 unknown
Publications
First: Transient expression of Ngn3 in Xenopus endoderm promotes early and ectopic development of pancreatic beta and delta cells., Genesis 2012                          
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556