Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249238

Morpholino Name: cbfa2t3 MO2
Synonyms: Eto2-MO2
mRNA Target: cbfa2t3

Morpholino Type:
Sequence:
5' CAATGGTCCCAGCAGAAGTAGATC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/24 24/24
genomic

MO
5' GATCTACTTCTGCTGGGACCATTG 3' |||||||||||||||||||||||| 3' CTAGATGAAGACGACCCTGGTAAC 5' 5' GATCTACTTCTGCTGGGACCATTG 3' |||||||||||||||||||||||| 3' CTAGATGAAGACGACCCTGGTAAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold10177:552209-552232 24/24 Antisense target cbfa2t3.L
Scaffold344679:79876-79899 24/24 Antisense off-target Xelaev16045067m
Scaffold67052:685664-685687 20/24 unknown
tropicalis 7.1 scaffold_4:43448336-43448359 24/24 Antisense target cbfa2t3
Publications
First: Uncoupling VEGFA functions in arteriogenesis and hematopoietic stem cell specification. [Dev Cell 2013]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556