Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249239

Morpholino Name: cbfa2t3 MO3
Synonyms: Eto2-MO
mRNA Target: cbfa2t3

Morpholino Type:
Sequence:
5' ATCAGCCGGTGAGTCTGGCATTGTA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' TACAATGCCAGACTCACCGGCTGAT 3' ||||||||||||||||||||||||| 3' ATGTTACGGTCTGAGTGGCCGACTA 5' 5' TACAATGCCAGACTCACCGGCTGAT 3' ||||||||||||||||||||||||| 3' ATGTTACGGTCTGAGTGGCCGACTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold10177:540517-540541 25/25 Antisense target cbfa2t3.L
Scaffold344679:65816-65840 25/25 Antisense off-target Xelaev16045067m
Scaffold100704:964527-964551 22/25 Antisense off-target Xelaev16000211m
Scaffold143831:4456540-4456564 21/25 unknown
Scaffold254257:81809-81833 21/25 Antisense off-target Xelaev16034241m
tropicalis 7.1 scaffold_4:43436287-43436311 25/25 Antisense target cbfa2t3
scaffold_2:68950096-68950120 21/25 unknown
scaffold_6:137184554-137184578 21/25 unknown
scaffold_6:22870347-22870371 21/25 Antisense off-target runx1t1
Publications
First: Uncoupling VEGFA functions in arteriogenesis and hematopoietic stem cell specification. [Dev Cell 2013]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556