Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249244

Morpholino Name: ccna1 MO1
Synonyms: cyclin A1
mRNA Target: ccna1

Morpholino Type: uncategorized morpholino
Sequence:
5' AATTTAGGTCAACTGCTACAACCAG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1L:36039713..36039737 21/25 unknown
chr2S:101691209..101691233 21/25 Sense off-target itgbl1.S
chr4L:49737493..49737517 21/25 Sense off-target nqo1.L
chr5L:98646033..98646057 21/25 Sense off-target tnk2.L
chr5S:107079105..107079129 21/25 unknown
chr5S:44529798..44529822 21/25 Antisense off-target scaf8.S
chr8S:67746016..67746040 21/25 unknown
chr9_10S:53299600..53299624 21/25 unknown
tropicalis 10.0 Chr4:111217547..111217571 22/25 Antisense off-target nek7
Chr2:159860078..159860102 21/25 Sense off-target atm
Publications
First: Cyclin A1/Cdk2 is sufficient but not required for the induction of apoptosis in early Xenopus laevis embryos., Cell Cycle 2006  
Most recent:
View All Papers