Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249256

Morpholino Name: cd44 MO1
Synonyms: XCD44-Mo1
mRNA Target: cd44

Morpholino Type: uncategorized morpholino
Sequence:
5' TGTGCTCCGCAGACAAGAGGCTCCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold25194:512676..512700 24/25 unknown
tropicalis 7.1 scaffold_1:203318280..203318304 21/25 Sense off-target LOC100490368
scaffold_2440:2952..2976 21/25 unknown
Publications
First: XHas2 activity is required during somitogenesis and precursor cell migration in Xenopus development., Development 2006                          
Most recent: Hyaluronan is required for cranial neural crest cells migration and craniofacial development., Dev Dyn 2012                
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556