Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249257

Morpholino Name: cd44 MO2
Synonyms: XCD44-Mo2
mRNA Target: cd44

Morpholino Type: uncategorized morpholino
Sequence:
5' TAACAATCCACAGCATTGAGGCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25 25/25 23/25
genomic

MO
5' ATGGCCCAACTGCTGTGGATTGTTA 3' |||||| | ||||||||||||||| 3' TACCGGAGTTACGACACCTAACAAT 5' 5' ATGGCCTCAATGCTGTGGATTGTTA 3' ||||||||||||||||||||||||| 3' TACCGGAGTTACGACACCTAACAAT 5' 5' ATGGCCCCACTGCTGTGGATTGTTA 3' |||||| || ||||||||||||||| 3' TACCGGAGTTACGACACCTAACAAT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr4L:8040482..8040506 25/25 Antisense target cd44.L
chr4S:15081049..15081073 23/25 Antisense target cd44.S
tropicalis 10.0 Chr4:11096490..11096514 22/25 Antisense target cd44
Chr8:43905839..43905863 21/25 Sense off-target LOC100496685
Publications
First: XHas2 activity is required during somitogenesis and precursor cell migration in Xenopus development., Development 2006                          
Most recent: CD44 functions in Wnt signaling by regulating LRP6 localization and activation., Cell Death Differ 2015  
View All Papers