Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249257

Morpholino Name: cd44 MO2
Synonyms: XCD44-Mo2
mRNA Target: cd44

Morpholino Type: uncategorized morpholino
Sequence:
5' TAACAATCCACAGCATTGAGGCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25
genomic

MO
5' ATGGCCCAACTGCTGTGGATTGTTA 3' |||||| | ||||||||||||||| 3' TACCGGAGTTACGACACCTAACAAT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold25194:512701..512725 25/25 unknown
Scaffold43483:1802979..1803003 23/25 Antisense off-target Xelaev16053771m
tropicalis 7.1 scaffold_4:6560270..6560294 22/25 Antisense target cd44
scaffold_8:24321673..24321697 21/25 unknown
Publications
First: XHas2 activity is required during somitogenesis and precursor cell migration in Xenopus development., Development 2006                          
Most recent: CD44 functions in Wnt signaling by regulating LRP6 localization and activation., Cell Death Differ 2015  
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556