Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249260

Morpholino Name: cdc42 MO1
Synonyms: TGas029e03, XtCDC42, cdc42 MO
mRNA Target: cdc42

Morpholino Type:
Sequence:
5' CTACACATTTAATTGTCTGCATGGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GCCATGCAGACAATTAAATGTGTAG 3' ||||||||||||||||||||||||| 3' CGGTACGTCTGTTAATTTACACATC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold109184:561789-561813 25/25 Antisense off-target Xelaev16002214m
Scaffold122517:382012-382036 25/25 Antisense off-target Xelaev16006140m
Scaffold23403:7625604-7625628 22/25 unknown
Scaffold9994:12579303-12579327 22/25 Antisense off-target rac1.L
Scaffold30470:427050-427074 21/25 unknown
Scaffold60608:2726560-2726584 21/25 unknown
Scaffold86967:2797127-2797151 21/25 Antisense off-target Xelaev16076791m
tropicalis 7.1 scaffold_7:88146218-88146242 25/25 Antisense target cdc42
scaffold_9:74314514-74314538 22/25 Antisense off-target rac1
scaffold_4:84574297-84574321 21/25 Antisense off-target rac2
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent: Regulation of neurogenesis by Fgf8a requires Cdc42 signaling and a novel Cdc42 effector protein. [Dev Biol 2013]
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556