Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249264

Morpholino Name: cdh1 MO1
Synonyms: E-cad MO, E-cad-MO
mRNA Target: cdh1

Morpholino Type: uncategorized morpholino
Sequence:
5' AACCAGGGCCTCTTCAACCCCATTG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CAATGGGGTTGAAGAGGCCCTGGTT 3' ||||||||||||||||||||||||| 3' GTTACCCCAACTTCTCCGGGACCAA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold57875:2476498..2476522 25/25 Antisense target cdh1.S
Scaffold202158:2716619..2716643 23/25 Antisense off-target Xelaev16025757m
tropicalis 7.1 scaffold_3:111295134..111295158 21/25 unknown
Publications
First: N- and E-cadherins in Xenopus are specifically required in the neural and non-neural ectoderm, respectively, for F-actin assembly and morphogenetic movements., Development 2009                        
Most recent: TBC1d24-ephrinB2 interaction regulates contact inhibition of locomotion in neural crest cell migration., Nat Commun 2018    
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.1


Major funding for Xenbase is provided by grant P41 HD064556