Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249271

Morpholino Name: cdknx MO1
Synonyms: Xic1 MO, p27Xic1, p27Xic1 MO
mRNA Target: cdknx

Morpholino Type: uncategorized morpholino
Sequence:
5' GCAGGGCGATGTGGAAAGCAGCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' ATGGCTGCCTTCCACATCGCCCTGC 3' |||||||| |||||||||||||||| 3' TACCGACGAAAGGTGTAGCGGGACG 5' 5' ATGGCTGCTTTCCACATCGCCCTGC 3' ||||||||||||||||||||||||| 3' TACCGACGAAAGGTGTAGCGGGACG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold402746:3953178..3953202 25/25 Antisense off-target Xelaev16051588m
Scaffold56777:5484658..5484682 25/25 Antisense target cdknx.L
Scaffold78587:1322806..1322830 21/25 unknown
tropicalis 7.1 scaffold_7:115077027..115077051 24/25 Antisense target cdknx
scaffold_7:72827635..72827659 21/25 Antisense off-target cadm1
Publications
First: The cdk inhibitor p27Xic1 is required for differentiation of primary neurones in Xenopus., Development 2003            
Most recent: Ascl1 phospho-status regulates neuronal differentiation in a Xenopus developmental model of neuroblastoma., Dis Model Mech 2015                  
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556