Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249275

Morpholino Name: cecr1 MO1
Synonyms: Xl_cecr1-1 MO
Target mRNA: ada2

Morpholino Type: uncategorized morpholino
Sequence: 5' ATGCACGTCATCTTAATTCTCTCAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 21/25
genomic

MO
5' CCCCTAGAATTAAGATGACGTGCAT 3' | |||||||||||||||||||| 3' GACTCTCTTAATTCTACTGCACGTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3S:5331311..5331335 21/25 Antisense target ada2.S
chr3S:5331311..5331335 21/25 Antisense off-target MGC68990
tropicalis 10.0 Chr10:11916522..11916546 21/25 Antisense off-target skap1
Publications
First: The extracellular adenosine deaminase growth factor, ADGF/CECR1, plays a role in Xenopus embryogenesis via the adenosine/P1 receptor., J Biol Chem 2008  
Most recent:
View All Papers