Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249276

Morpholino Name: cecr1 MO2
Synonyms: Xcecr1-1-5'UTR MO
Target mRNA: ada2

Morpholino Type: uncategorized morpholino
Sequence: 5' ATTCTCTCAGTCTCCTCTAATCCTG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25
genomic

MO
5' CAGGATTAGAGGAGACTGAGAGGTT 3' |||||||||||||||||||||| | 3' GTCCTAATCTCCTCTGACTCTCTTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3S:5328027..5328051 23/25 Antisense target ada2.S
chr3S:5328027..5328051 23/25 Antisense off-target MGC68990
chr9_10S:16397880..16397904 21/25 Antisense off-target LOC108702664 [provisional:trim7]
chr9_10L:81074699..81074723 21/25 Antisense off-target fastkd2.L
chr1L:136487001..136487025 21/25 unknown
Publications
First: The extracellular adenosine deaminase growth factor, ADGF/CECR1, plays a role in Xenopus embryogenesis via the adenosine/P1 receptor., J Biol Chem 2008  
Most recent:
View All Papers