Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249278

Morpholino Name: cecr1 MO4
Synonyms: Xcecr1-2-5'UTR MO
Target mRNA: ada2

Morpholino Type: uncategorized morpholino
Sequence: 5' TAATTCTCTCTCTCCTCTAATCCTG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1L:182504334..182504358 21/25 Sense off-target rasa1.L
chr4S:21950430..21950454 21/25 Antisense off-target sox6.S
chr4S:21950430..21950454 21/25 Antisense off-target LOC108715311
Scaffold73491:142..166 22/25 unknown
Scaffold117:217712..217736 21/25 unknown
chr3L:134258988..134259012 21/25 unknown
chr4L:58061917..58061941 21/25 unknown
chr6S:37335952..37335976 21/25 unknown
tropicalis 10.0 Chr2:165881443..165881467 22/25 Antisense off-target slc36a4
Chr3:92191164..92191188 21/25 Antisense off-target arih1
Chr6:107161868..107161892 21/25 Antisense off-target emilin2
Chr5:17186629..17186653 21/25 unknown
Chr6:98062750..98062774 21/25 unknown
Publications
First: The extracellular adenosine deaminase growth factor, ADGF/CECR1, plays a role in Xenopus embryogenesis via the adenosine/P1 receptor., J Biol Chem 2008  
Most recent:
View All Papers