Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249279

Morpholino Name: celf1 MO1
Synonyms: E-Mo, EDEN-BP MO
mRNA Target: celf1

Morpholino Type: uncategorized morpholino
Sequence:
5' TTGTGCCATTCATTATCTTAGAAAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25 24/25 22/25
genomic

MO
5' AGTTCCAAGAAAATGAATGGCACAA 3' | ||| |||| |||||||||||||| 3' TAAAGATTCTATTACTTACCGTGTT 5' 5' AGTTCTAAGATAATGAATGGCACAA 3' | ||||||||||||||||||||||| 3' TAAAGATTCTATTACTTACCGTGTT 5' 5' AGTTCCAAGAAAATGAATGGCACAA 3' | ||| |||| |||||||||||||| 3' TAAAGATTCTATTACTTACCGTGTT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr4L:11530167..11530191 24/25 Antisense target celf1.L
chr4S:11639977..11640001 22/25 Antisense target celf1.S
chr1L:13822946..13822970 21/25 Sense off-target LOC108697749 [provisional:cfap99]
chr5S:43618481..43618505 21/25 Sense off-target LOC108717854 [provisional:zdhhc14]
chr1L:162326618..162326642 21/25 Sense off-target kntc1.L
chr5L:96356738..96356762 21/25 unknown
chr5S:80225103..80225127 21/25 unknown
chr6L:4739710..4739734 21/25 unknown
tropicalis 10.0 Chr4:16164192..16164216 22/25 Antisense target celf1
Chr10:22284324..22284348 21/25 Antisense off-target cntnap1
Chr2:171155351..171155375 21/25 Sense off-target dlg2
Publications
First: EDEN-BP-dependent post-transcriptional regulation of gene expression in Xenopus somitic segmentation., Development 2004                    
Most recent: CUG-BP, Elav-like family member 1 (CELF1) is required for normal myofibrillogenesis, morphogenesis, and contractile function in the embryonic heart., Dev Dyn 2016                        
View All Papers