Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249280

Morpholino Name: celf1 MO2
Synonyms: E-Mo, EDEN-BP MO
mRNA Target: celf1

Morpholino Type: uncategorized morpholino
Sequence:
5' ATTGTGCCATTCATTTTCTTGGAAA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 22/25 24/25
genomic

MO
5' GTTCCAAGAAAATGAATGGCACAAT 3' |||||||||||||||||||||||| 3' AAAGGTTCTTTTACTTACCGTGTTA 5' 5' GTTCTAAGATAATGAATGGCACAAT 3' ||| |||| ||||||||||||||| 3' AAAGGTTCTTTTACTTACCGTGTTA 5' 5' GTTCCAAGAAAATGAATGGCACAAT 3' |||||||||||||||||||||||| 3' AAAGGTTCTTTTACTTACCGTGTTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr4S:11639976..11640000 24/25 Antisense target celf1.S
chr4L:11530166..11530190 22/25 Antisense target celf1.L
chr1S:1261799..1261823 22/25 Sense off-target Xelaev18008698m
chr3S:26259642..26259666 22/25 Antisense off-target LOC108712290 [provisional:ckap2l]
chr9_10S:10242230..10242254 22/25 Sense off-target nfatc2.S
chr2L:100167217..100167241 21/25 Sense off-target LOC105946711.L
chr2L:61066166..61066190 21/25 Sense off-target lhx1.L
chr3S:55089260..55089284 21/25 Sense off-target fam189a1.S
chr4L:44659103..44659127 21/25 Antisense off-target nudt7.L
chr5S:22060013..22060037 21/25 Sense off-target LOC108717536 [provisional:gch1]
chr6S:55615389..55615413 21/25 Sense off-target Xetrov90016534m.S
chr8L:68902004..68902028 21/25 Sense off-target LOC100189574
chr8L:68902004..68902028 21/25 Antisense off-target fancm.L
chr4L:28972903..28972927 21/25 Sense off-target actn3.L
chr6L:4739709..4739733 23/25 unknown
chr4S:65816666..65816690 22/25 unknown
chr5L:30328193..30328217 22/25 unknown
chr5S:364824..364848 22/25 unknown
chr1L:38213299..38213323 21/25 unknown
chr1S:60502028..60502052 21/25 unknown
chr2L:119148357..119148381 21/25 unknown
chr2S:114907355..114907379 21/25 unknown
chr2S:40631100..40631124 21/25 unknown
chr4S:10000902..10000926 21/25 unknown
chr4S:46180765..46180789 21/25 unknown
chr5S:23479895..23479919 21/25 unknown
chr6S:112338132..112338156 21/25 unknown
chr8L:35446297..35446321 21/25 unknown
chr8L:67489038..67489062 21/25 unknown
tropicalis 10.0 Chr4:16164193..16164217 24/25 Antisense target celf1
Chr4:104063273..104063297 22/25 Antisense off-target fnbp1l
Chr1:76300319..76300343 21/25 Sense off-target bmpr1b
Chr3:125951676..125951700 21/25 Antisense off-target ckap2l
Chr4:12806321..12806345 21/25 Sense off-target fgf4
Chr7:21756672..21756696 21/25 Sense off-target tcerg1l
Chr3:136901550..136901574 22/25 unknown
Chr1:209347802..209347826 21/25 unknown
Chr2:18984771..18984795 21/25 unknown
Chr2:94486944..94486968 21/25 unknown
Chr6:62659625..62659649 21/25 unknown
Publications
First: EDEN-BP-dependent post-transcriptional regulation of gene expression in Xenopus somitic segmentation., Development 2004                    
Most recent: CUG-BP, Elav-like family member 1 (CELF1) is required for normal myofibrillogenesis, morphogenesis, and contractile function in the embryonic heart., Dev Dyn 2016                        
View All Papers