Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249284

Morpholino Name: cer1 MO1
Synonyms: Cer, cerberus morpholino
mRNA Target: cer1

Morpholino Type: uncategorized morpholino
Sequence:
5' CTAGACCCTGCAGTGTTTCTGAGCG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CGCTCAGAAACACTGCAGGGTCTAG 3' ||||||||||||||||||||||||| 3' GCGAGTCTTTGTGACGTCCCAGATC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold185879:2742003..2742027 25/25 Antisense target cer1.S
Scaffold45965:257495..257519 22/25 Antisense off-target Xelaev16055565m
Scaffold50694:5002842..5002866 21/25 unknown
Scaffold93416:1570327..1570351 21/25 unknown
tropicalis 7.1 scaffold_3:71273231..71273255 21/25 unknown
Publications
First: Endogenous Cerberus activity is required for anterior head specification in Xenopus., Development 2003                
Most recent: Multiple functions of Cerberus cooperate to induce heart downstream of Nodal., Dev Biol 2007          
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556