Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249284

Morpholino Name: cer1 MO1
Synonyms: Cer, cerberus morpholino
Target mRNA: cer1

Morpholino Type: uncategorized morpholino
Sequence: 5' CTAGACCCTGCAGTGTTTCTGAGCG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CGCTCAGAAACACTGCAGGGTCTAG 3' ||||||||||||||||||||||||| 3' GCGAGTCTTTGTGACGTCCCAGATC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1S:101038797..101038821 25/25 Antisense target cer1.S
chr1L:122035452..122035476 22/25 Sense off-target LOC108714006
chr1L:122035452..122035476 22/25 Antisense off-target LOC108713989 [provisional:cer1]
chr8L:48745269..48745293 21/25 unknown
chr5L:144114542..144114566 21/25 unknown
tropicalis 10.0 Chr3:42799170..42799194 21/25 unknown
Publications
First: Endogenous Cerberus activity is required for anterior head specification in Xenopus., Development 2003                
Most recent: Multiple functions of Cerberus cooperate to induce heart downstream of Nodal., Dev Biol 2007          
View All Papers