Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249285

Morpholino Name: cer1 MO2
Synonyms: Cer MO, Cerberus MO
mRNA Target: cer1

Morpholino Type: uncategorized morpholino
Sequence:
5' ACTTGCTGTTCCTGCACTGTG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 21/21
genomic

MO
5' CACAGTGCAGGAACAGCAAGT 3' ||||||||||||||||||||| 3' GTGTCACGTCCTTGTCGTTCA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold185879:2741982..2742002 21/21 Antisense target cer1.S
Scaffold45965:257474..257494 21/21 Antisense off-target Xelaev16055565m
Scaffold57180:609248..609268 20/21 unknown
Scaffold122740:191245..191265 19/21 unknown
Scaffold37448:1852419..1852439 19/21 unknown
Scaffold57216:2270797..2270817 19/21 unknown
Scaffold156846:2037000..2037020 18/21 Antisense off-target Xelaev16016486m
Scaffold171879:765098..765118 18/21 unknown
Scaffold39723:9949792..9949812 18/21 Sense off-target rab4b.L
Scaffold54653:54109..54129 18/21 Antisense off-target bckdk.S
Scaffold70222:413502..413522 18/21 Antisense off-target Xelaev16069225m
Scaffold16807:1977601..1977621 17/21 Sense off-target Xelaev16019379m
Scaffold178713:3132354..3132374 17/21 unknown
Scaffold187321:938527..938547 17/21 unknown
Scaffold243760:564157..564177 17/21 unknown
Scaffold24467:549167..549187 17/21 unknown
Scaffold316387:71523..71543 17/21 Sense off-target Xelaev16042273m
Scaffold3272:3005767..3005787 17/21 unknown
Scaffold36364:7837675..7837695 17/21 unknown
Scaffold52170:24482..24502 17/21 unknown
Scaffold52341:2105319..2105339 17/21 Sense off-target Xelaev16059816m
Scaffold53263:2798972..2798992 17/21 unknown
Scaffold6590:6797894..6797914 17/21 unknown
Scaffold67052:273580..273600 17/21 unknown
Scaffold69443:7743044..7743064 17/21 unknown
Scaffold78860:4034627..4034647 17/21 unknown
Scaffold9266:408676..408696 17/21 unknown
tropicalis 7.1 scaffold_1:198361855..198361875 19/21 unknown
scaffold_2:107023143..107023163 19/21 unknown
scaffold_2:107023295..107023315 19/21 unknown
scaffold_2:107023333..107023353 19/21 unknown
scaffold_2:107023371..107023391 19/21 unknown
scaffold_2:107023447..107023467 19/21 unknown
scaffold_2:107023523..107023543 19/21 unknown
scaffold_6:115749376..115749396 19/21 Sense off-target rundc3b
scaffold_7:25966913..25966933 19/21 unknown
scaffold_9:68787777..68787797 19/21 unknown
scaffold_1:111388572..111388592 18/21 unknown
scaffold_2:107023067..107023087 18/21 unknown
scaffold_2:107023105..107023125 18/21 unknown
scaffold_2:107023181..107023201 18/21 unknown
scaffold_2:107023219..107023239 18/21 unknown
scaffold_2:107023257..107023277 18/21 unknown
scaffold_2:107023409..107023429 18/21 unknown
scaffold_2:107023485..107023505 18/21 unknown
scaffold_2:24082571..24082591 18/21 Antisense off-target mbtps2
scaffold_23:227088..227108 18/21 unknown
scaffold_23:272193..272213 18/21 unknown
scaffold_23:312448..312468 18/21 unknown
scaffold_23:348665..348685 18/21 unknown
scaffold_23:398711..398731 18/21 unknown
scaffold_23:454430..454450 18/21 unknown
scaffold_23:624646..624666 18/21 unknown
scaffold_8:103768874..103768894 18/21 Antisense off-target cadm3
scaffold_1:51697332..51697352 17/21 Antisense off-target galnt9
scaffold_23:114179..114199 17/21 unknown
scaffold_23:193650..193670 17/21 unknown
scaffold_5:46512704..46512724 17/21 Sense off-target ascc3
scaffold_9:25307695..25307715 17/21 unknown
scaffold_98:178095..178115 17/21 unknown
Publications
First: Neural induction in Xenopus: requirement for ectodermal and endomesodermal signals via Chordin, Noggin, beta-Catenin, and Cerberus., PLoS Biol 2004                  
Most recent: Regulation of ADMP and BMP2/4/7 at opposite embryonic poles generates a self-regulating morphogenetic field., Cell 2005                        
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556