Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249285

Morpholino Name: cer1 MO2
Synonyms: Cer MO, Cerberus MO
Target mRNA: cer1

Morpholino Type: uncategorized morpholino
Sequence: 5' ACTTGCTGTTCCTGCACTGTG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 21/21
genomic

MO
5' CACAGTGCAGGAACAGCAAGT 3' ||||||||||||||||||||| 3' GTGTCACGTCCTTGTCGTTCA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1S:101038776..101038796 21/21 Antisense target cer1.S
chr1L:122035431..122035451 21/21 Sense off-target LOC108714006
chr1L:122035431..122035451 21/21 Antisense off-target LOC108713989 [provisional:cer1]
chr6S:70871805..70871825 20/21 Antisense off-target cdh10.S
chr9_10S:101039083..101039103 19/21 Sense off-target septin12.S
Scaffold87:414584..414604 18/21 Antisense off-target bckdk.S
chr2L:140923715..140923735 18/21 Antisense off-target lrp1.L
chr8L:56635460..56635480 18/21 Sense off-target rab4b.L
chr8L:102165138..102165158 18/21 Antisense off-target cadm3.L
Scaffold24:710681..710701 17/21 Sense off-target Xelaev18001784m
Scaffold24:710681..710701 17/21 Sense off-target LOC108704021 [provisional:erc2]
chr1L:4822969..4822989 17/21 Sense off-target slc4a11.L
chr1S:57033091..57033111 17/21 Antisense off-target LOC108706710 [provisional:ank2]
chr2L:122536910..122536930 17/21 Antisense off-target LOC108708487 [provisional:gpc6]
chr7L:99259004..99259024 17/21 Sense off-target tnnt1.L
chr8S:45372025..45372045 17/21 Sense off-target LOC108700042 [provisional:astn2]
chr6S:29189461..29189481 19/21 unknown
chr8L:3493215..3493235 19/21 unknown
chr7L:26403974..26403994 18/21 unknown
chr1S:75516163..75516183 17/21 unknown
chr2L:15285433..15285453 17/21 unknown
chr2L:158687130..158687150 17/21 unknown
chr2S:214631..214651 17/21 unknown
chr3L:91817513..91817533 17/21 unknown
chr4L:84787088..84787108 17/21 unknown
chr4L:86963759..86963779 17/21 unknown
chr4S:72846932..72846952 17/21 unknown
chr6L:38533403..38533423 17/21 unknown
chr6L:85229761..85229781 17/21 unknown
chr7L:40141523..40141543 17/21 unknown
tropicalis 10.0 Chr2:155854316..155854336 19/21 Antisense off-target atp8a2
Chr2:155854430..155854450 19/21 Antisense off-target atp8a2
Chr2:155854506..155854526 19/21 Antisense off-target atp8a2
Chr2:155854620..155854640 19/21 Antisense off-target atp8a2
Chr2:155854696..155854716 19/21 Antisense off-target atp8a2
Chr2:155854734..155854754 19/21 Antisense off-target atp8a2
Chr2:155854772..155854792 19/21 Antisense off-target atp8a2
Chr2:155855076..155855096 19/21 Antisense off-target atp8a2
Chr2:155854810..155854830 19/21 Antisense off-target atp8a2
Chr2:155854924..155854944 19/21 Antisense off-target atp8a2
Chr2:155854962..155854982 19/21 Antisense off-target atp8a2
Chr6:29387440..29387460 19/21 Sense off-target rundc3b
Chr7:31458624..31458644 19/21 Sense off-target kcnip2
Chr2:155854202..155854222 18/21 Antisense off-target atp8a2
Chr2:155854278..155854298 18/21 Antisense off-target atp8a2
Chr2:155854354..155854374 18/21 Antisense off-target atp8a2
Chr2:155854392..155854412 18/21 Antisense off-target atp8a2
Chr2:155854468..155854488 18/21 Antisense off-target atp8a2
Chr2:155854544..155854564 18/21 Antisense off-target atp8a2
Chr2:155854582..155854602 18/21 Antisense off-target atp8a2
Chr2:155854658..155854678 18/21 Antisense off-target atp8a2
Chr2:155855038..155855058 18/21 Antisense off-target atp8a2
Chr2:44390245..44390265 18/21 Antisense off-target mbtps2
Chr2:155854848..155854868 18/21 Antisense off-target atp8a2
Chr2:155854886..155854906 18/21 Antisense off-target atp8a2
Chr2:155855000..155855020 18/21 Antisense off-target atp8a2
Chr3:133618565..133618585 18/21 Sense off-target LOC101731168
Chr3:133792130..133792150 18/21 Sense off-target LOC101731226
Chr3:133511265..133511285 18/21 Sense off-target LOC100486944
Chr3:133562605..133562625 18/21 Sense off-target LOC101731168
Chr8:125710898..125710918 18/21 Antisense off-target cadm3
Chr1:156246078..156246098 17/21 Antisense off-target galnt9
Chr5:81509253..81509273 17/21 Sense off-target ascc3
Chr6:73353055..73353075 17/21 Antisense off-target tmem245
Chr1:21977173..21977193 19/21 unknown
Chr9:32214268..32214288 19/21 unknown
Chr1:109769069..109769089 18/21 unknown
Chr3:133388405..133388425 18/21 unknown
Chr3:133434050..133434070 18/21 unknown
Chr3:133475078..133475098 18/21 unknown
Chr3:133278495..133278515 17/21 unknown
Chr3:133354506..133354526 17/21 unknown
Chr9:50064732..50064752 17/21 unknown
Publications
First: Neural induction in Xenopus: requirement for ectodermal and endomesodermal signals via Chordin, Noggin, beta-Catenin, and Cerberus., PLoS Biol 2004                  
Most recent: Regulation of ADMP and BMP2/4/7 at opposite embryonic poles generates a self-regulating morphogenetic field., Cell 2005                        
View All Papers