Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249286

Morpholino Name: cer1 MO3
Synonyms: Cer-MO, Cer1
mRNA Target: cer1

Morpholino Type: uncategorized morpholino
Sequence:
5' ACTTGCTGTTCCTGCACTGTGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/22
genomic

MO
5' GCACAGTGCAGGAACAGCAAGT 3' |||||||||||||||||||||| 3' CGTGTCACGTCCTTGTCGTTCA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold185879:2741981..2742002 22/22 Antisense target cer1.S
Scaffold45965:257473..257494 22/22 Antisense off-target Xelaev16055565m
Scaffold122740:191245..191266 20/22 unknown
Scaffold57180:609248..609269 20/22 unknown
Scaffold118142:1133979..1134000 19/22 unknown
Scaffold156846:2037000..2037021 19/22 Antisense off-target Xelaev16016486m
Scaffold1684:474681..474702 19/22 unknown
Scaffold37448:1852419..1852440 19/22 unknown
Scaffold57216:2270797..2270818 19/22 unknown
Scaffold16807:1977600..1977621 18/22 Sense off-target Xelaev16019379m
Scaffold171879:765097..765118 18/22 unknown
Scaffold316387:71523..71544 18/22 Sense off-target Xelaev16042273m
Scaffold32212:1535478..1535499 18/22 Sense off-target Xelaev16042775m
Scaffold36364:7837675..7837696 18/22 unknown
Scaffold39723:9949791..9949812 18/22 Sense off-target rab4b.L
Scaffold52170:24482..24503 18/22 unknown
Scaffold53263:620108..620129 18/22 unknown
Scaffold54653:54108..54129 18/22 Antisense off-target bckdk.S
Scaffold58517:3310432..3310453 18/22 unknown
Scaffold6590:6797894..6797915 18/22 unknown
Scaffold70222:413501..413522 18/22 Antisense off-target Xelaev16069225m
Scaffold78860:4034627..4034648 18/22 unknown
Scaffold9266:408675..408696 18/22 unknown
tropicalis 7.1 scaffold_2:107023142..107023163 20/22 unknown
scaffold_2:107023294..107023315 20/22 unknown
scaffold_2:107023332..107023353 20/22 unknown
scaffold_2:107023370..107023391 20/22 unknown
scaffold_2:107023446..107023467 20/22 unknown
scaffold_2:107023522..107023543 20/22 unknown
scaffold_1:198361855..198361876 19/22 unknown
scaffold_2:107023066..107023087 19/22 unknown
scaffold_2:107023104..107023125 19/22 unknown
scaffold_2:107023180..107023201 19/22 unknown
scaffold_2:107023218..107023239 19/22 unknown
scaffold_2:107023256..107023277 19/22 unknown
scaffold_2:107023408..107023429 19/22 unknown
scaffold_2:107023484..107023505 19/22 unknown
scaffold_6:115749376..115749397 19/22 Sense off-target rundc3b
scaffold_7:25966912..25966933 19/22 unknown
scaffold_8:103768873..103768894 19/22 Antisense off-target cadm3
scaffold_9:68787777..68787798 19/22 unknown
scaffold_1:111388571..111388592 18/22 unknown
scaffold_2:24082570..24082591 18/22 Antisense off-target mbtps2
scaffold_23:227088..227109 18/22 unknown
scaffold_23:272193..272214 18/22 unknown
scaffold_23:312448..312469 18/22 unknown
scaffold_23:348665..348686 18/22 unknown
scaffold_23:398711..398732 18/22 unknown
scaffold_23:454430..454451 18/22 unknown
scaffold_23:624645..624666 18/22 unknown
scaffold_5:26836854..26836875 18/22 unknown
Publications
First: Neural induction in Xenopus: requirement for ectodermal and endomesodermal signals via Chordin, Noggin, beta-Catenin, and Cerberus., PLoS Biol 2004                  
Most recent: Regulation of ADMP and BMP2/4/7 at opposite embryonic poles generates a self-regulating morphogenetic field., Cell 2005                        
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556