Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249286

Morpholino Name: cer1 MO3
Synonyms: Cer-MO, Cer1
mRNA Target: cer1

Morpholino Type: uncategorized morpholino
Sequence:
5' ACTTGCTGTTCCTGCACTGTGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/22
genomic

MO
5' GCACAGTGCAGGAACAGCAAGT 3' |||||||||||||||||||||| 3' CGTGTCACGTCCTTGTCGTTCA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1L:122035430..122035451 22/22 Sense off-target LOC108714006
chr1L:122035430..122035451 22/22 Antisense off-target LOC108713989 [provisional:cer1]
chr1S:101038775..101038796 22/22 Antisense target cer1.S
chr6S:70871804..70871825 20/22 Antisense off-target cdh10.S
chr9_10S:101039083..101039104 20/22 Sense off-target septin12.S
chr5L:47291109..47291130 19/22 Antisense off-target crim1.L
chr6S:29189461..29189482 19/22 unknown
chr7L:48723262..48723283 19/22 unknown
chr8L:102165137..102165158 19/22 Antisense off-target cadm3.L
chr8L:3493215..3493236 19/22 unknown
chr1S:75516163..75516184 18/22 unknown
chr2L:122536910..122536931 18/22 Antisense off-target LOC108708487 [provisional:gpc6]
chr2L:140923714..140923735 18/22 Antisense off-target lrp1.L
chr2L:15285433..15285454 18/22 unknown
chr2S:214630..214651 18/22 unknown
chr3L:91817512..91817533 18/22 unknown
chr4L:84787088..84787109 18/22 unknown
chr5L:109109072..109109093 18/22 unknown
chr7L:26403973..26403994 18/22 unknown
Scaffold24:710681..710702 18/22 Sense off-target Xelaev18001784m
Scaffold24:710681..710702 18/22 Sense off-target LOC108704021 [provisional:erc2]
Scaffold87:414584..414605 18/22 Antisense off-target bckdk.S
chr1S:152494647..152494668 18/22 Sense off-target edil3.S
chr7L:40141523..40141544 18/22 unknown
chr8L:56635460..56635481 18/22 Sense off-target rab4b.L
tropicalis 10.0 Chr2:155854315..155854336 20/22 Antisense off-target atp8a2
Chr2:155854429..155854450 20/22 Antisense off-target atp8a2
Chr2:155854505..155854526 20/22 Antisense off-target atp8a2
Chr2:155854619..155854640 20/22 Antisense off-target atp8a2
Chr2:155854695..155854716 20/22 Antisense off-target atp8a2
Chr2:155854733..155854754 20/22 Antisense off-target atp8a2
Chr2:155854771..155854792 20/22 Antisense off-target atp8a2
Chr2:155854809..155854830 20/22 Antisense off-target atp8a2
Chr2:155854923..155854944 20/22 Antisense off-target atp8a2
Chr2:155854961..155854982 20/22 Antisense off-target atp8a2
Chr2:155855075..155855096 20/22 Antisense off-target atp8a2
Chr2:155854201..155854222 19/22 Antisense off-target atp8a2
Chr2:155854277..155854298 19/22 Antisense off-target atp8a2
Chr2:155854353..155854374 19/22 Antisense off-target atp8a2
Chr2:155854391..155854412 19/22 Antisense off-target atp8a2
Chr2:155854467..155854488 19/22 Antisense off-target atp8a2
Chr2:155854543..155854564 19/22 Antisense off-target atp8a2
Chr2:155854581..155854602 19/22 Antisense off-target atp8a2
Chr2:155854657..155854678 19/22 Antisense off-target atp8a2
Chr1:21977173..21977194 19/22 unknown
Chr2:155854847..155854868 19/22 Antisense off-target atp8a2
Chr2:155854885..155854906 19/22 Antisense off-target atp8a2
Chr2:155854999..155855020 19/22 Antisense off-target atp8a2
Chr2:155855037..155855058 19/22 Antisense off-target atp8a2
Chr6:29387440..29387461 19/22 Sense off-target rundc3b
Chr7:31458623..31458644 19/22 Sense off-target kcnip2
Chr8:125710897..125710918 19/22 Antisense off-target cadm3
Chr9:32214267..32214288 19/22 unknown
Chr1:109769068..109769089 18/22 unknown
Chr2:44390244..44390265 18/22 Antisense off-target mbtps2
Chr3:133388405..133388426 18/22 unknown
Chr3:133434050..133434071 18/22 unknown
Chr3:133475078..133475099 18/22 unknown
Chr3:133511265..133511286 18/22 Sense off-target LOC100486944
Chr3:133562605..133562626 18/22 Sense off-target LOC101731168
Chr3:133618565..133618586 18/22 Sense off-target LOC101731168
Chr3:133792129..133792150 18/22 Sense off-target LOC101731226
Chr5:137350990..137351011 18/22 unknown
Publications
First: Neural induction in Xenopus: requirement for ectodermal and endomesodermal signals via Chordin, Noggin, beta-Catenin, and Cerberus., PLoS Biol 2004                  
Most recent: Regulation of ADMP and BMP2/4/7 at opposite embryonic poles generates a self-regulating morphogenetic field., Cell 2005                        
View All Papers