Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249287

Morpholino Name: cer1 MO4
Synonyms: cerberus MO
Target mRNA: cer1

Morpholino Type: uncategorized morpholino
Sequence: 5' AGATCCTGAGTACATTTAGTAACAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATGTTACTAAATGTACTCAGGATCT 3' ||||||||||||||||||||||||| 3' TACAATGATTTACATGAGTCCTAGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1S:101038832..101038856 25/25 Antisense target cer1.S
chr4S:52492730..52492754 21/25 Sense off-target ttll7.S
chr2L:96099802..96099826 21/25 Sense off-target psph.L
chr7L:68106887..68106911 21/25 Antisense off-target ei24.L
chr7L:68106887..68106911 21/25 Sense off-target fez1.L
chr1L:193849138..193849162 22/25 unknown
chr1S:140018700..140018724 21/25 unknown
chr6L:115874303..115874327 21/25 unknown
tropicalis 10.0 Chr2:116996628..116996652 21/25 Sense off-target arhgef7
Publications
First: Coordination of BMP-3b and cerberus is required for head formation of Xenopus embryos., Dev Biol 2003                              
Most recent:
View All Papers