Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249291

Morpholino Name: chd7 MO1
Synonyms: Chd7 MO
Target mRNA: chd7

Morpholino Type: uncategorized morpholino
Sequence: 5' AACTCATCATGCCAGGGTCTGCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' ATGGCAGACCCTGGCATGATGAGTT 3' ||||||||||||||||||||||||| 3' TACCGTCTGGGACCGTACTACTCAA 5' 5' ATGGCAGACCCTGGCATGATGAGTT 3' ||||||||||||||||||||||||| 3' TACCGTCTGGGACCGTACTACTCAA 5' 5' ATGGCAGACCCTGGCATGATGAGTT 3' ||||||||||||||||||||||||| 3' TACCGTCTGGGACCGTACTACTCAA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6L:117963100..117963124 25/25 Antisense target chd7.L
chr6S:94055676..94055700 25/25 Antisense target chd7.S
Scaffold38405:225..249 22/25 unknown
Scaffold16930:593..617 21/25 unknown
Scaffold23:4039647..4039671 21/25 unknown
Scaffold25757:371..395 21/25 unknown
Scaffold30655:207..231 21/25 unknown
Scaffold3666:49..73 21/25 unknown
Scaffold38:546474..546498 21/25 unknown
Scaffold38955:246..270 21/25 unknown
Scaffold41797:215..239 21/25 unknown
Scaffold511:946..970 21/25 unknown
Scaffold5546:479..503 21/25 unknown
Scaffold6252:419..443 21/25 unknown
Scaffold67940:108..132 21/25 unknown
Scaffold736:533..557 21/25 unknown
Scaffold82:207546..207570 21/25 unknown
chr5L:61723092..61723116 21/25 unknown
chr5S:52922509..52922533 21/25 unknown
chr7L:54199050..54199074 21/25 unknown
chr8L:101324394..101324418 21/25 unknown
Scaffold743:227..251 21/25 unknown
tropicalis 10.0 Chr6:117149966..117149990 25/25 Antisense target chd7
Chr5:20271391..20271415 21/25 Sense off-target ttc7a
Publications
First: CHD7 cooperates with PBAF to control multipotent neural crest formation., Nature 2010        
Most recent: Sema3a plays a role in the pathogenesis of CHARGE syndrome., Hum Mol Genet 2018    
View All Papers