Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249294

Morpholino Name: chrd MO1
Synonyms: Chd MO, Chd MO1, Chd-MO, Chd-MO1, ChdMO
mRNA Target: chrd.1

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence:
5' ACGTTCTGTCTCGTATAGTGAGCGT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ACGCTCACTATACGAGACAGAACGT 3' ||||||||||||||||||||||||| 3' TGCGAGTGATATGCTCTGTCTTGCA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold29016:1255946..1255970 25/25 Antisense target chrd.1.S
Publications
First: Chordin is required for the Spemann organizer transplantation phenomenon in Xenopus embryos., Dev Cell 2003                
Most recent: Development: scaling to size by protease inhibition., Curr Biol 2013      
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556