Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249294

Morpholino Name: chrd.1 MO1
Synonyms: Chd MO, Chd-MO, Chd-MO1, chordin MO, chrd MO1
Target mRNA: chrd.1

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence: 5' ACGTTCTGTCTCGTATAGTGAGCGT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ACGCTCACTATACGAGACAGAACGT 3' ||||||||||||||||||||||||| 3' TGCGAGTGATATGCTCTGTCTTGCA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr5S:81693902..81693926 25/25 Antisense target chrd.1.S
Publications
First: Chordin is required for the Spemann organizer transplantation phenomenon in Xenopus embryos., Dev Cell 2003                
Most recent: R-spondins are BMP receptor antagonists in Xenopus early embryonic development., Nat Commun 2020                                              
View All Papers