Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249295

Morpholino Name: chrd MO10
Synonyms: Chd-MO1
mRNA Target: chrd.1

Morpholino Type: uncategorized morpholino
Sequence:
5' ACGTTGTGTGTGGTATAGTGAGGGT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold16863:4149960..4149984 22/25 Antisense off-target Xelaev16019855m
Publications
First: Expression of Siamois and Twin in the blastula Chordin/Noggin signaling center is required for brain formation in Xenopus laevis embryos., Mech Dev 2008                
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556