Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249296

Morpholino Name: chrd MO2
Synonyms: Chd MO2, Chd-MO, Chd-MO2, Chordin 1, Chordin 2
mRNA Target: chrd.1

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' ACAGCATTTTTGTGGTTGTCCCGAA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 21/25
genomic

MO
5' CTCGGGGCTACCACAAAAATGCTTT 3' ||||| | |||||||||||||| | 3' AAGCCCTGTTGGTGTTTTTACGACA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold76530:253847..253871 25/25 Antisense off-target Xelaev16072752m
Scaffold12271:195565..195589 21/25 unknown
Scaffold196571:394815..394839 21/25 Sense off-target Xelaev16024988m
Scaffold227742:23150..23174 21/25 unknown
tropicalis 7.1 scaffold_5:10693951..10693975 21/25 Antisense target chrd.1
scaffold_8:22673866..22673890 21/25 unknown
Publications
First: Chordin is required for the Spemann organizer transplantation phenomenon in Xenopus embryos., Dev Cell 2003                
Most recent: Development: scaling to size by protease inhibition., Curr Biol 2013      
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556