Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249296

Morpholino Name: chrd.1 MO2
Synonyms: Chd MO2, Chd-MO, Chd-MO2, Chordin 1, Chordin 2
Target mRNA: chrd.1

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' ACAGCATTTTTGTGGTTGTCCCGAA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 21/25 23/25
genomic

MO
5' CTCGGGGCTACCACAAAAATGCTTT 3' ||||| | |||||||||||||| | 3' AAGCCCTGTTGGTGTTTTTACGACA 5' 5' TTCAGGACTACCACAAAAATGCTGT 3' ||| |||| |||||||||||||||| 3' AAGCCCTGTTGGTGTTTTTACGACA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr5L:97277967..97277991 23/25 Antisense target chrd.1.L
chr5L:97331623..97331647 25/25 Antisense off-target chrd.2.L
chr2S:65749335..65749359 21/25 Sense off-target col8a2.S
Scaffold30:388764..388788 21/25 unknown
chr5L:69648971..69648995 21/25 unknown
tropicalis 10.0 Chr5:99618063..99618087 21/25 Antisense target chrd.1
Chr8:41085274..41085298 21/25 unknown
Publications
First: Chordin is required for the Spemann organizer transplantation phenomenon in Xenopus embryos., Dev Cell 2003                
Most recent: R-spondins are BMP receptor antagonists in Xenopus early embryonic development., Nat Commun 2020                                              
View All Papers