Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249297

Morpholino Name: chrd MO3
Synonyms: chordin, chordin MO
mRNA Target: chrd.1

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' GGACACTGCATTTTTGTGGTTCCAA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TTGGAACCACAAAAATGCAGTGTCC 3' ||||||||||||||||||||||||| 3' AACCTTGGTGTTTTTACGTCACAGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold29016:1255971..1255995 25/25 Antisense target chrd.1.S
Scaffold187321:3740158..3740182 21/25 unknown
Scaffold2410:49..73 21/25 unknown
Scaffold6590:14069618..14069642 21/25 unknown
tropicalis 7.1 scaffold_6:14195774..14195798 21/25 Antisense off-target csmd3
scaffold_9:14292941..14292965 21/25 unknown
Publications
First: Dkk1 and noggin cooperate in mammalian head induction., Genes Dev 2003  
Most recent: Negative feedback in the bone morphogenetic protein 4 (BMP4) synexpression group governs its dynamic signaling range and canalizes development., Proc Natl Acad Sci U S A 2011        
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556