Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249298

Morpholino Name: chrd MO4
Synonyms: ChdA-MO, chdA MO
mRNA Target: chrd.1

Morpholino Type: uncategorized morpholino
Sequence:
5' CAGCATTTTTGTGGTTGTCCCGAAC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 21/25
genomic

MO
5' GCTCGGGGCTACCACAAAAATGCTT 3' | ||||| | |||||||||||||| 3' CAAGCCCTGTTGGTGTTTTTACGAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold76530:253848..253872 25/25 Antisense off-target Xelaev16072752m
Scaffold196571:394814..394838 21/25 Sense off-target Xelaev16024988m
Scaffold9266:11164244..11164268 21/25 unknown
tropicalis 7.1 scaffold_5:10693952..10693976 21/25 Antisense target chrd.1
scaffold_8:22673865..22673889 21/25 unknown
Publications
First: Twisted gastrulation loss-of-function analyses support its role as a BMP inhibitor during early Xenopus embryogenesis., Development 2003                
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556