Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249299

Morpholino Name: chrd MO5
Synonyms: ChdB-MO, chdB MO
mRNA Target: chrd.1

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' GGGACACTGCATTTTTGTGGTTCCA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TGGAACCACAAAAATGCAGTGTCCC 3' ||||||||||||||||||||||||| 3' ACCTTGGTGTTTTTACGTCACAGGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold29016:1255972..1255996 25/25 Antisense target chrd.1.S
Scaffold120240:1435621..1435645 21/25 unknown
Scaffold187321:3740157..3740181 21/25 unknown
Scaffold2410:48..72 21/25 unknown
Scaffold6590:7300977..7301001 21/25 Sense off-target Xelaev16067564m
tropicalis 7.1 scaffold_6:14195775..14195799 22/25 Antisense off-target csmd3
Publications
First: Twisted gastrulation loss-of-function analyses support its role as a BMP inhibitor during early Xenopus embryogenesis., Development 2003                
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556