Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249300

Morpholino Name: chrd MO6
Synonyms: chordin MO
mRNA Target: chrd.1

Morpholino Type: uncategorized morpholino
Sequence:
5' CAAAGCATTTTGTGGTAGCCCCGA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold57094:577446..577469 21/24 unknown
Scaffold24467:1440769..1440792 20/24 unknown
tropicalis 7.1 scaffold_18:1458351..1458374 20/24 unknown
scaffold_3:55439635..55439658 20/24 Sense off-target fat2
scaffold_69:208480..208503 20/24 unknown
scaffold_8:44670343..44670366 20/24 unknown
Publications
First: Twisted gastrulation is required for forebrain specification and cooperates with Chordin to inhibit BMP signaling during X. tropicalis gastrulation., Dev Biol 2006                                    
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556