Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249301

Morpholino Name: chrd MO7
Synonyms: chordin MO
mRNA Target: chrd.1

Morpholino Type: uncategorized morpholino
Sequence:
5' CAAAGCATTTTTGTGGTAGCCCCGA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TCGGGGCTACCACAAAAATGCTTTG 3' ||||||||||||||||||||||||| 3' AGCCCCGATGGTGTTTTTACGAAAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold139741:482542..482566 22/25 unknown
Scaffold76530:253846..253870 22/25 Antisense off-target Xelaev16072752m
tropicalis 7.1 scaffold_5:10693950..10693974 25/25 Antisense target chrd.1
Publications
First: Depletion of three BMP antagonists from Spemann''s organizer leads to a catastrophic loss of dorsal structures., Dev Cell 2005                            
Most recent: Noggin is required for first pharyngeal arch differentiation in the frog Xenopus tropicalis., Dev Biol 2017                  
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556