Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249303

Morpholino Name: chrd MO9
Synonyms: chordin
mRNA Target: chrd.1

Morpholino Type: uncategorized morpholino
Sequence:
5' ATCCACAGCAGCCCCTCCATCATCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold26364:3024231..3024255 22/25 unknown
Scaffold112487:166021..166045 21/25 unknown
Scaffold144023:6056..6080 21/25 unknown
Scaffold66475:4934813..4934837 21/25 unknown
tropicalis 7.1 scaffold_5:87631172..87631196 21/25 Antisense off-target ninl
Publications
First: Photocaged morpholino oligomers for the light-regulation of gene function in zebrafish and Xenopus embryos., J Am Chem Soc 2010  
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556