Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249308

Morpholino Name: ckap5 MO2
Synonyms: XMAP215
mRNA Target: ckap5

Morpholino Type: uncategorized morpholino
Sequence:
5' TCATCCACTCGCTGTCATCCCCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' ATGGGGGATGACAGTGAGTGGATGA 3' |||||||||||||| |||||||||| 3' TACCCCCTACTGTCGCTCACCTACT 5' 5' ATGGGGGATGACAGCGAGTGGATGA 3' ||||||||||||||||||||||||| 3' TACCCCCTACTGTCGCTCACCTACT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold185603:282305..282329 25/25 Antisense target ckap5.S
Scaffold43483:989870..989894 24/25 Antisense off-target Xelaev16053752m
Scaffold51558:352832..352856 21/25 Antisense off-target Xelaev16059144m
tropicalis 7.1 scaffold_4:10568515..10568539 24/25 Antisense target ckap5
Publications
First: Growth cone-specific functions of XMAP215 in restricting microtubule dynamics and promoting axonal outgrowth., Neural Dev 2013            
Most recent: XMAP215 promotes microtubule-F-actin interactions to regulate growth cone microtubules during axon guidance in Xenopuslaevis., J Cell Sci 2019                        
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.13.1
Major funding for Xenbase is provided by grant P41 HD064556