Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249309

Morpholino Name: ascl1 MO2
Synonyms: Xash1a MO, ckm MO1
mRNA Target: ascl1

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' AGGTCTCCATGCTGATAGGCTGATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CATCAGCCTATCAGCATGGAGACCT 3' ||||||||||||||||||||||||| 3' GTAGTCGGATAGTCGTACCTCTGGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3S:95729572..95729596 25/25 Antisense target ascl1.S
chr1L:57494254..57494278 21/25 Antisense off-target LOC108699681
chr9_10S:49106552..49106576 21/25 unknown
tropicalis 10.0 Chr2:57424256..57424280 21/25 unknown
Chr4:99669411..99669435 21/25 unknown
Chr5:147360772..147360796 21/25 unknown
Chr8:1272912..1272936 21/25 Sense off-target LOC100488863
Publications
First: Xenopus zinc finger transcription factor IA1 (Insm1) expression marks anteroventral noradrenergic neuron progenitors in Xenopus embryos., Dev Dyn 2008            
Most recent: Ascl1 as a novel player in the Ptf1a transcriptional network for GABAergic cell specification in the retina., PLoS One 2014                          
View All Papers