Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249309

Morpholino Name: ascl1 MO2
Synonyms: Xash1a MO, ckm MO1
mRNA Target: ascl1

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' AGGTCTCCATGCTGATAGGCTGATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold5925:8048349..8048373 25/25 Antisense off-target Xelaev16064810m
Scaffold60608:1278426..1278450 21/25 unknown
Scaffold88765:990907..990931 21/25 Antisense off-target Xelaev16077406m
tropicalis 7.1 scaffold_2:54195995..54196019 21/25 unknown
scaffold_232:79044..79068 21/25 unknown
scaffold_9:91264963..91264987 21/25 unknown
Publications
First: Xenopus zinc finger transcription factor IA1 (Insm1) expression marks anteroventral noradrenergic neuron progenitors in Xenopus embryos., Dev Dyn 2008            
Most recent: Ascl1 as a novel player in the Ptf1a transcriptional network for GABAergic cell specification in the retina., PLoS One 2014                        
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556