Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249330

Morpholino Name: ctnnb1 MO1
Synonyms: -catenin, -catenin-MO, anti-b-catenin morpholino, b-cat-MO, b-catenin
mRNA Target: ctnnb1

Morpholino Type:
Sequence:
5' TTTCAACCGTTTCCAAAGAACCAGG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25 24/25
genomic

MO
5' CCTGGTTCTTTGGAAACTGTTGAAA 3' ||||||||||||||||| ||||||| 3' GGACCAAGAAACCTTTGCCAACTTT 5' 5' CCTGGTTCTTTGGAAACGGTTGAAA 3' ||||||||||||||||||||||||| 3' GGACCAAGAAACCTTTGCCAACTTT 5' 5' CCTGGTTCTTTGGAAACTGTTGAAA 3' ||||||||||||||||| ||||||| 3' GGACCAAGAAACCTTTGCCAACTTT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold343399:656619..656643 25/25 Antisense target ctnnb1.L
Scaffold3267:717650..717674 24/25 Antisense target ctnnb1.S
Scaffold243569:15399..15423 21/25 Antisense off-target Xelaev16032384m
Scaffold47457:2555658..2555682 21/25 unknown
Scaffold51808:417815..417839 21/25 unknown
tropicalis 7.1 scaffold_6:92381215..92381239 24/25 Antisense target ctnnb1
scaffold_6:19958795..19958819 21/25 unknown
Publications
First: Beta-catenin signaling activity dissected in the early Xenopus embryo: a novel antisense approach. [Dev Biol 2000]
Most recent: Embryonic regeneration by relocalization of the Spemann organizer during twinning in Xenopus. [Proc Natl Acad Sci U S A 2018]
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556