Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249331

Morpholino Name: ctnnb1 MO2
Synonyms: bcat, beta-catenin morpholino
mRNA Target: ctnnb1

Morpholino Type:
Sequence:
5' TTTCAACAGTTTCCAAAGAACCAGG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 24/25 25/25
genomic

MO
5' CCTGGTTCTTTGGAAACTGTTGAAA 3' ||||||||||||||||||||||||| 3' GGACCAAGAAACCTTTGACAACTTT 5' 5' CCTGGTTCTTTGGAAACGGTTGAAA 3' ||||||||||||||||| ||||||| 3' GGACCAAGAAACCTTTGACAACTTT 5' 5' CCTGGTTCTTTGGAAACTGTTGAAA 3' ||||||||||||||||||||||||| 3' GGACCAAGAAACCTTTGACAACTTT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold3267:717650..717674 25/25 Antisense target ctnnb1.S
Scaffold343399:656619..656643 24/25 Antisense target ctnnb1.L
Scaffold51808:417815..417839 22/25 unknown
Scaffold11316:3791234..3791258 21/25 unknown
Scaffold18184:3021369..3021393 21/25 Antisense off-target Xelaev16022181m
Scaffold243569:15399..15423 21/25 Antisense off-target Xelaev16032384m
Scaffold33269:682812..682836 21/25 unknown
Scaffold45400:779552..779576 21/25 unknown
Scaffold47457:2555658..2555682 21/25 unknown
Scaffold52702:3178444..3178468 21/25 unknown
Scaffold75398:1022213..1022237 21/25 unknown
Scaffold9266:7117934..7117958 21/25 Sense off-target Xelaev16078814m
tropicalis 7.1 scaffold_6:92381215..92381239 25/25 Antisense target ctnnb1
scaffold_3:32307235..32307259 21/25 unknown
scaffold_4:74832019..74832043 21/25 Sense off-target prg4
scaffold_6:66837812..66837836 21/25 unknown
scaffold_8:32978799..32978823 21/25 unknown
Publications
First: Techniques and probes for the study of Xenopus tropicalis development. [Dev Dyn 2002]
Most recent: Identification of novel transcripts with differential dorso-ventral expression in Xenopus gastrula using serial analysis of gene expression. [Genome Biol 2009]
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.0
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556