Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249331

Morpholino Name: ctnnb1 MO2
Synonyms: bcat, beta-catenin morpholino
Target mRNA: ctnnb1

Morpholino Type: uncategorized morpholino
Sequence: 5' TTTCAACAGTTTCCAAAGAACCAGG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 25/25
genomic

MO
5' CCTGGTTCTTTGGAAACTGTTGAAA 3' ||||||||||||||||||||||||| 3' GGACCAAGAAACCTTTGACAACTTT 5' 5' CCTGGTTCTTTGGAAACGGTTGAAA 3' ||||||||||||||||| ||||||| 3' GGACCAAGAAACCTTTGACAACTTT 5' 5' CCTGGTTCTTTGGAAACTGTTGAAA 3' ||||||||||||||||||||||||| 3' GGACCAAGAAACCTTTGACAACTTT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6S:45048005..45048029 25/25 Antisense target ctnnb1.S
chr6L:51732505..51732529 24/25 Antisense target ctnnb1.L
chr2L:68122707..68122731 22/25 Sense off-target LOC108708155 [provisional:cpne5]
chr8L:52234788..52234812 21/25 Antisense off-target LOC108698939 [provisional:cfb]
Scaffold54:1048052..1048076 21/25 Antisense off-target LOC108704858 [provisional:ttc31]
chr3L:44027452..44027476 21/25 Antisense off-target LOC108711038 [provisional:dnah3]
chr3L:98454285..98454309 21/25 Sense off-target unc45a.L
chr5S:73495903..73495927 21/25 unknown
chr7L:84573928..84573952 21/25 unknown
chr2S:11033077..11033101 21/25 unknown
chr2S:150124467..150124491 21/25 unknown
chr5S:10014662..10014686 21/25 unknown
tropicalis 10.0 Chr6:53369028..53369052 25/25 Antisense target ctnnb1
Chr4:119773021..119773045 21/25 Sense off-target prg4
Chr6:82995286..82995310 21/25 Sense off-target cdh9
Chr3:117338308..117338332 21/25 unknown
Publications
First: Techniques and probes for the study of Xenopus tropicalis development., Dev Dyn 2002            
Most recent: Sox17 and β-catenin co-occupy Wnt-responsive enhancers to govern the endoderm gene regulatory network., Elife 2020                        
View All Papers