Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249346

Morpholino Name: cyp26a1 MO1
Synonyms: Cyp26a1
mRNA Target: cyp26a1

Morpholino Type: uncategorized morpholino
Sequence:
5' TAGTGAGCAGAGTATACAGATCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25 25/25
genomic

MO
5' ATGGATCTATACACTCTGCTCACCA 3' |||||||| || ||||||||||| | 3' TACCTAGACATATGAGACGAGTGAT 5' 5' ATGGATCTGTATACTCTGCTCACTA 3' ||||||||||||||||||||||||| 3' TACCTAGACATATGAGACGAGTGAT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold7555:3441895..3441919 25/25 Antisense target cyp26a1.L
Scaffold16863:3786060..3786084 23/25 Antisense off-target Xelaev16019848m
Scaffold41523:7364979..7365003 21/25 Antisense off-target mep1a.L
Scaffold5228:1092810..1092834 21/25 unknown
tropicalis 7.1 scaffold_7:95450027..95450051 23/25 unknown
scaffold_7:32268659..32268683 22/25 Antisense target cyp26a1
scaffold_6:84184558..84184582 21/25 unknown
Publications
First: ERF and ETV3L are retinoic acid-inducible repressors required for primary neurogenesis., Development 2013                                                                
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556