Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249346

Morpholino Name: cyp26a1 MO1
Synonyms: Cyp26a1
Target mRNA: cyp26a1

Morpholino Type: uncategorized morpholino
Sequence: 5' TAGTGAGCAGAGTATACAGATCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25 25/25 23/25
genomic

MO
5' ATGGATCTATACACTCTGCTCACCA 3' |||||||| || ||||||||||| | 3' TACCTAGACATATGAGACGAGTGAT 5' 5' ATGGATCTGTATACTCTGCTCACTA 3' ||||||||||||||||||||||||| 3' TACCTAGACATATGAGACGAGTGAT 5' 5' ATGGATCTGTACACTCTGCTCACCA 3' ||||||||||| ||||||||||| | 3' TACCTAGACATATGAGACGAGTGAT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr7L:20080235..20080259 25/25 Antisense target cyp26a1.L
chr7S:15633126..15633150 23/25 Antisense target cyp26a1.S
chr5L:147574971..147574995 21/25 Antisense off-target mep1a.L
chr6L:57461681..57461705 21/25 unknown
tropicalis 10.0 Chr7:25310500..25310524 22/25 Antisense target cyp26a1
Chr7:100483917..100483941 23/25 Sense off-target camta1
Chr6:59207057..59207081 21/25 unknown
Publications
First: ERF and ETV3L are retinoic acid-inducible repressors required for primary neurogenesis., Development 2013                                                                
Most recent:
View All Papers