Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249350

Morpholino Name: daam1 MO1
Synonyms: daam1 MO
mRNA Target: daam1

Morpholino Type: uncategorized morpholino
Sequence:
5' GCCGCAGGTCTGTCAGTTGCTTCTA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 25/25 22/25
genomic

MO
5' TAAAAGCAACTGACAGACCTGTGGC 3' || |||||||||||||||||| ||| 3' ATCTTCGTTGACTGTCTGGACGCCG 5' 5' TAGAAGCAACTGACAGACCTGCGGC 3' ||||||||||||||||||||||||| 3' ATCTTCGTTGACTGTCTGGACGCCG 5' 5' TGAAAGCAACTGACAGACCTGTGGC 3' | |||||||||||||||||| ||| 3' ATCTTCGTTGACTGTCTGGACGCCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8L:79739942..79739966 25/25 Antisense target daam1.L
chr8S:7381542..7381566 22/25 Antisense target daam1.S
chr3L:19303201..19303225 21/25 unknown
chr5S:76336672..76336696 21/25 unknown
tropicalis 10.0 Chr8:103047466..103047490 23/25 Antisense target daam1
Chr6:23265625..23265649 21/25 unknown
Publications
First: Wnt/Frizzled activation of Rho regulates vertebrate gastrulation and requires a novel Formin homology protein Daam1., Cell 2001    
Most recent: Developmentally regulated GTP-binding protein 1 modulates ciliogenesis via an interaction with Dishevelled., J Cell Biol 2019                
View All Papers