Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249350

Morpholino Name: daam1 MO1
Synonyms: daam1 MO
mRNA Target: daam1

Morpholino Type: uncategorized morpholino
Sequence:
5' GCCGCAGGTCTGTCAGTTGCTTCTA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 22/25
genomic

MO
5' TAAAAGCAACTGACAGACCTGTGGC 3' || |||||||||||||||||| ||| 3' ATCTTCGTTGACTGTCTGGACGCCG 5' 5' TGAAAGCAACTGACAGACCTGTGGC 3' | |||||||||||||||||| ||| 3' ATCTTCGTTGACTGTCTGGACGCCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold45985:918546..918570 25/25 Antisense off-target Xelaev16055635m
Scaffold133644:827594..827618 22/25 Antisense target daam1.S
Scaffold15893:865711..865735 21/25 unknown
Scaffold52702:6019213..6019237 21/25 unknown
tropicalis 7.1 scaffold_8:82035116..82035140 23/25 Antisense target daam1
scaffold_6:122167846..122167870 21/25 unknown
Publications
First: Wnt/Frizzled activation of Rho regulates vertebrate gastrulation and requires a novel Formin homology protein Daam1., Cell 2001    
Most recent: Developmentally regulated GTP-binding protein 1 modulates ciliogenesis via an interaction with Dishevelled., J Cell Biol 2019                
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556