Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249350

Morpholino Name: daam1 MO1
Synonyms: daam1 MO
mRNA Target: daam1

Morpholino Type:
Sequence:
5' GCCGCAGGTCTGTCAGTTGCTTCTA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 22/25
genomic

MO
5' TAAAAGCAACTGACAGACCTGTGGC 3' || |||||||||||||||||| ||| 3' ATCTTCGTTGACTGTCTGGACGCCG 5' 5' TGAAAGCAACTGACAGACCTGTGGC 3' | |||||||||||||||||| ||| 3' ATCTTCGTTGACTGTCTGGACGCCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold45985:918546..918570 25/25 Antisense off-target Xelaev16055635m
Scaffold133644:827594..827618 22/25 Antisense target daam1.S
Scaffold15893:865711..865735 21/25 unknown
Scaffold52702:6019213..6019237 21/25 unknown
tropicalis 7.1 scaffold_8:82035116..82035140 23/25 Antisense target daam1
scaffold_6:122167846..122167870 21/25 unknown
Publications
First: Wnt/Frizzled activation of Rho regulates vertebrate gastrulation and requires a novel Formin homology protein Daam1. [Cell 2001]
Most recent: The polarity protein Inturned links NPHP4 to Daam1 to control the subapical actin network in multiciliated cells. [J Cell Biol 2015]
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.8.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556