Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249352

Morpholino Name: dab2 MO2
Synonyms: XDab2 MO2
mRNA Target: dab2

Morpholino Type:
Sequence:
5' CACAATCATTAAATAAGAGTCAGAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 21/25
genomic

MO
5' GCTTGACTCTTATTTAATGATCGTG 3' |||||||||||||||||| ||| 3' TAGACTGAGAATAAATTACTAACAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold52441:7372668-7372692 25/25 Antisense off-target Xelaev16060168m
Scaffold47457:936861-936885 22/25 unknown
Scaffold137317:3005394-3005418 21/25 unknown
Scaffold20345:4720284-4720308 21/25 Antisense off-target Xelaev16026279m
Scaffold51452:277301-277325 21/25 Antisense off-target Xelaev16058991m
tropicalis 7.1 scaffold_3:102510637-102510661 22/25 unknown
scaffold_1:25831834-25831858 21/25 Antisense target dab2
Publications
First: Xenopus Dab2 is required for embryonic angiogenesis. [BMC Dev Biol 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556