Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249353

Morpholino Name: dact1 MO1
Synonyms: FrdMO, XDPR MO
Target mRNA: dact1

Morpholino Type: uncategorized morpholino
Sequence: 5' CAGGGGCGGCGGGGATCGGCTTCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' ATGAAGCCGATCCCCGCCACCCCTG 3' |||||||||||||||||| |||||| 3' TACTTCGGCTAGGGGCGGCGGGGAC 5' 5' ATGAAGCCGATCCCCGCCGCCCCTG 3' ||||||||||||||||||||||||| 3' TACTTCGGCTAGGGGCGGCGGGGAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8L:80064219..80064243 25/25 Antisense target dact1.L
chr1L:175662446..175662470 22/25 Sense off-target man2a1.L
tropicalis 10.0 Chr8:103323942..103323966 24/25 Antisense target dact1
Publications
First: Dapper, a Dishevelled-associated antagonist of beta-catenin and JNK signaling, is required for notochord formation., Dev Cell 2002    
Most recent: The involvement of Frodo in TCF-dependent signaling and neural tissue development., Development 2004        
View All Papers