Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249353

Morpholino Name: dact1 MO1
Synonyms: FrdMO, XDPR MO
mRNA Target: dact1

Morpholino Type:
Sequence:
5' CAGGGGCGGCGGGGATCGGCTTCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' ATGAAGCCGATCCCCGCCACCCCTG 3' |||||||||||||||||| |||||| 3' TACTTCGGCTAGGGGCGGCGGGGAC 5' 5' ATGAAGCCGATCCCCGCCGCCCCTG 3' ||||||||||||||||||||||||| 3' TACTTCGGCTAGGGGCGGCGGGGAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold45985:594269-594293 25/25 Antisense target dact1.L
Scaffold1187:428834-428858 22/25 Sense off-target Xelaev16004779m
tropicalis 7.1 scaffold_8:82310497-82310521 24/25 Antisense target dact1
Publications
First: Dapper, a Dishevelled-associated antagonist of beta-catenin and JNK signaling, is required for notochord formation. [Dev Cell 2002]
Most recent: The involvement of Frodo in TCF-dependent signaling and neural tissue development. [Development 2004]
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556