Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249354

Morpholino Name: dact1 MO2
Synonyms: Frodo, Frodo morpholino
mRNA Target: dact1

Morpholino Type:
Sequence:
5' ATGGGCTTCATCCTGGGACAGCGA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/24 24/24
genomic

MO
5' TCGCTGTCCCAGGATGAAGCCGAT 3' ||||||||||||||||||||| || 3' AGCGACAGGGTCCTACTTCGGGTA 5' 5' TCGCTGTCCCAGGATGAAGCCCAT 3' |||||||||||||||||||||||| 3' AGCGACAGGGTCCTACTTCGGGTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold133644:1080635-1080658 24/24 Antisense target dact1.S
Scaffold58038:2806464-2806487 20/24 unknown
tropicalis 7.1 scaffold_8:82310511-82310534 23/24 Antisense target dact1
scaffold_8046:1725-1748 20/24 unknown
scaffold_9:54168659-54168682 20/24 unknown
Publications
First: Frodo interacts with Dishevelled to transduce Wnt signals. [Nat Cell Biol 2002]
Most recent: Delamination of neural crest cells requires transient and reversible Wnt inhibition mediated by Dact1/2. [Development 2016]
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556