Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249355

Morpholino Name: dag1 MO1
Synonyms: Dg-Mo1, DgMo, dag1 MO, dg MO1
Target mRNA: dag1

Morpholino Type: uncategorized morpholino
Sequence: 5' CAGCACACCTAATATCCATTTTGGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 23/25
genomic

MO
5' ACCAAAATGGATATTAGGTGTGCTG 3' |||||||||||||||||||||||| 3' CGGTTTTACCTATAATCCACACGAC 5' 5' GCCAAAATGGATATTAGGTGTGCTG 3' ||||||||||||||||||||||||| 3' CGGTTTTACCTATAATCCACACGAC 5' 5' ACCAAAATGGATATTCGGTGTGCTG 3' |||||||||||||| ||||||||| 3' CGGTTTTACCTATAATCCACACGAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr4L:119176291..119176315 25/25 Antisense target dag1.L
chr4S:98293921..98293945 23/25 Antisense target dag1.S
chr1L:144984215..144984239 21/25 unknown
tropicalis 10.0 Chr4:125725611..125725635 24/25 Antisense target dag1
Chr10:21162093..21162117 21/25 Antisense off-target tmc6
Chr4:26654050..26654074 21/25 Sense off-target LOC116410388
Chr8:101099399..101099423 21/25 Sense off-target LOC100488825
Chr8:97513744..97513768 21/25 Antisense off-target mok
Chr9:42213001..42213025 21/25 Antisense off-target card11
Publications
First: A function for dystroglycan in pronephros development in Xenopus laevis., Dev Biol 2008            
Most recent: An adhesome comprising laminin, dystroglycan and myosin IIA is required during notochord development in Xenopus laevis., Development 2014                        
View All Papers