Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249355

Morpholino Name: dag1 MO1
Synonyms: Dg-Mo1, DgMo, dag1 MO, dg MO1
mRNA Target: dag1

Morpholino Type:
Sequence:
5' CAGCACACCTAATATCCATTTTGGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' ACCAAAATGGATATTAGGTGTGCTG 3' |||||||||||||||||||||||| 3' CGGTTTTACCTATAATCCACACGAC 5' 5' GCCAAAATGGATATTAGGTGTGCTG 3' ||||||||||||||||||||||||| 3' CGGTTTTACCTATAATCCACACGAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold187321:5297167-5297191 25/25 Antisense target dag1.L
Scaffold107347:1374696-1374720 23/25 Antisense off-target Xelaev16002010m
Scaffold229342:388057-388081 21/25 unknown
tropicalis 7.1 scaffold_6:137724120-137724144 24/25 Antisense target dag1
scaffold_10:24702036-24702060 21/25 Antisense off-target tmc6
scaffold_4:54900123-54900147 21/25 unknown
scaffold_8:25258962-25258986 21/25 unknown
scaffold_8:75925002-75925026 21/25 Antisense off-target mok
scaffold_8:79121735-79121759 21/25 unknown
Publications
First: A function for dystroglycan in pronephros development in Xenopus laevis. [Dev Biol 2008]
Most recent: An adhesome comprising laminin, dystroglycan and myosin IIA is required during notochord development in Xenopus laevis. [Development 2014]
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556