Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249357

Morpholino Name: dag1 MO3
Synonyms: Mo-X-DG
mRNA Target: dag1

Morpholino Type:
Sequence:
5' TACAGCGTAGGAGGCAGCTTGTCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/24
genomic

MO
5' AGACGAGCTGCCTCCTACGCTGTA 3' |||| ||||||||||||||||||| 3' TCTGTTCGACGGAGGATGCGACAT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold187321:5297199-5297222 23/24 Antisense target dag1.L
Scaffold107347:1374728-1374751 21/24 Antisense off-target Xelaev16002010m
tropicalis 7.1 scaffold_1:62622790-62622813 21/24 unknown
scaffold_1:84321528-84321551 20/24 unknown
scaffold_7:61938329-61938352 20/24 unknown
Publications
First: Dystroglycan is required for proper retinal layering. [Dev Biol 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556