Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249357

Morpholino Name: dag1 MO3
Synonyms: Mo-X-DG
mRNA Target: dag1

Morpholino Type: uncategorized morpholino
Sequence:
5' TACAGCGTAGGAGGCAGCTTGTCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/24 21/24
genomic

MO
5' AGACGAGCTGCCTCCTACGCTGTA 3' |||| ||||||||||||||||||| 3' TCTGTTCGACGGAGGATGCGACAT 5' 5' AGACGCGTTGCCTCCTACGCTGTA 3' |||| | |||||||||||||||| 3' TCTGTTCGACGGAGGATGCGACAT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr4L:119176260..119176283 23/24 Antisense target dag1.L
chr4S:98293890..98293913 21/24 Antisense target dag1.S
tropicalis 10.0 Chr1:145289212..145289235 21/24 Sense off-target iqcd
Chr1:145289212..145289235 21/24 Antisense off-target tpcn1
Chr1:133629830..133629853 20/24 unknown
Chr7:64513696..64513719 20/24 Sense off-target LOC101731286
Publications
First: Dystroglycan is required for proper retinal layering., Dev Biol 2006              
Most recent:
View All Papers