Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249358

Morpholino Name: dand5 MO1
Synonyms: Coco1 MO, coco MO
mRNA Target: dand5

Morpholino Type:
Sequence:
5' CTGGTGGCCTGGAACAACAGCATGT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold49557:885231..885255 25/25 Antisense off-target Xelaev16057997m
Scaffold55171:178856..178880 24/25 Antisense off-target Xelaev16062169m
Scaffold207705:229993..230017 21/25 unknown
Publications
First: The left-right axis is regulated by the interplay of Coco, Xnr1 and derrière in Xenopus embryos. [Dev Biol 2007]
Most recent: Leftward Flow Determines Laterality in Conjoined Twins. [Curr Biol 2017]
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556