Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249358

Morpholino Name: dand5 MO1
Synonyms: Coco1 MO, coco MO
Target mRNA: dand5

Morpholino Type: uncategorized morpholino
Sequence: 5' CTGGTGGCCTGGAACAACAGCATGT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' ACATGCTGCTGTTCCAGGCCACCAG 3' |||||||| |||||||||||||||| 3' TGTACGACAACAAGGTCCGGTGGTC 5' 5' ACATGCTGTTGTTCCAGGCCACCAG 3' ||||||||||||||||||||||||| 3' TGTACGACAACAAGGTCCGGTGGTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 Scaffold20:1268072..1268096 25/25 Antisense target dand5.S
chr3L:132359290..132359314 24/25 Antisense target dand5.L
Scaffold52:1044562..1044586 21/25 unknown
Publications
First: The left-right axis is regulated by the interplay of Coco, Xnr1 and derrière in Xenopus embryos., Dev Biol 2007                
Most recent: Leftward Flow Determines Laterality in Conjoined Twins., Curr Biol 2017                  
View All Papers