Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249359

Morpholino Name: dand5 MO2
Synonyms: Coco2 MO
mRNA Target: dand5

Morpholino Type: uncategorized morpholino
Sequence:
5' TGGTGGCCTGGAACAGCAGCATGTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold55171:178857..178881 25/25 Antisense off-target Xelaev16062169m
Scaffold49557:885230..885254 24/25 Antisense off-target Xelaev16057997m
Scaffold227593:51720..51744 22/25 Antisense off-target Xelaev16029508m
Publications
First: The left-right axis is regulated by the interplay of Coco, Xnr1 and derrière in Xenopus embryos., Dev Biol 2007                
Most recent: Leftward Flow Determines Laterality in Conjoined Twins., Curr Biol 2017                  
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556