Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249359

Morpholino Name: dand5 MO2
Synonyms: Coco2 MO
Target mRNA: dand5

Morpholino Type: uncategorized morpholino
Sequence: 5' TGGTGGCCTGGAACAGCAGCATGTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25 25/25 24/25
genomic

MO
5' AACATGCTGCTGTTCCGGGCCGCCA 3' ||||||||||||||| |||| ||| 3' CTGTACGACGACAAGGTCCGGTGGT 5' 5' GACATGCTGCTGTTCCAGGCCACCA 3' ||||||||||||||||||||||||| 3' CTGTACGACGACAAGGTCCGGTGGT 5' 5' GACATGCTGTTGTTCCAGGCCACCA 3' ||||||||| ||||||||||||||| 3' CTGTACGACGACAAGGTCCGGTGGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:132359291..132359315 25/25 Antisense target dand5.L
Scaffold20:1268073..1268097 24/25 Antisense target dand5.S
chr4L:52891239..52891263 22/25 Antisense off-target plcg2.L
tropicalis 10.0 Chr3:139673961..139673985 22/25 Antisense target dand5
Publications
First: The left-right axis is regulated by the interplay of Coco, Xnr1 and derrière in Xenopus embryos., Dev Biol 2007                
Most recent: Leftward Flow Determines Laterality in Conjoined Twins., Curr Biol 2017                  
View All Papers