Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249360

Morpholino Name: dazap2 MO1
Synonyms: DZ2-MO
mRNA Target: dazap2

Morpholino Type: uncategorized morpholino
Sequence:
5' CTTTATTATTCATAGCTCCGGGTTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 22/25
genomic

MO
5' GAACCCGGGGCAATGAATAATAAAG 3' |||||||| || ||||||||||||| 3' CTTGGGCCTCGATACTTATTATTTC 5' 5' AAACCCGGGGCAATGAATAATAAAG 3' ||||||| || ||||||||||||| 3' CTTGGGCCTCGATACTTATTATTTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold133382:4193480..4193504 25/25 Antisense off-target Xelaev16009662m
Scaffold5732:3089490..3089514 22/25 Antisense target dazap2.S
tropicalis 7.1 scaffold_2:85831375..85831399 23/25 Antisense target dazap2
Publications
First: Dazap2 is required for FGF-mediated posterior neural patterning, independent of Wnt and Cdx function., Dev Biol 2009                                
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556